Stem-loop sequence vvi-MIR171h

AccessionMI0006542 (change log)
DescriptionVitis vinifera miR171h stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention vvi-MIR171h
(18 sentences)

Stem-loop
   --uuuc   a                    u   ug   u   c   a 
5'       acg gauguuggugcgguucaacc aac  uag guc aug a
         ||| |||||||||||||||||||| |||  ||| ||| |||  
3'       ugc cuauaaccgcgccgaguugg uug  guc cag uau u
   ucuauc   c                    u   ua   u   c   g 
Get sequence
Deep sequencing
1125 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 1828653-1828748 [-]
intergenic
Database links

Mature sequence vvi-miR171h

Accession MIMAT0005697
Sequence

66 - 

ugguugagccgcgccaauauc

 - 86

Get sequence
Deep sequencing1097 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).