Stem-loop sequence vvi-MIR171i

AccessionMI0006543 (change log)
DescriptionVitis vinifera miR171i stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

4 open access papers mention vvi-MIR171i
(14 sentences)

Stem-loop
   --gaa   g   gg        a            a  c   ucu        
5'      gaa gug  gauguugg auggcucaauca au aaa   cccaagg 
        ||| |||  |||||||| |||||||||||| || |||   |||||| g
3'      cuu uac  cuauaacc ugccgaguuagu ua uuu   ggguuuu 
   cuuca   g   ua        g            c  a   ccu        
Get sequence
Deep sequencing
1205 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 893534-893636 [+]
intergenic
Database links

Mature sequence vvi-miR171i

Accession MIMAT0005698
Sequence

69 - 

ugauugagccgugccaauauc

 - 89

Get sequence
Deep sequencing1146 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).