Stem-loop sequence vvi-MIR172b

AccessionMI0006545 (change log)
DescriptionVitis vinifera miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

9 open access papers mention vvi-MIR172b
(33 sentences)

Stem-loop
   --ua    c a  c                u  accccaaaacuugaggcagcgaagau 
5'     uugc g ug agcaucaucaagauuc ca                          g
       |||| | || |||||||||||||||| ||                           
3'     aacg c ac ucguaguaguucuaag gu                          g
   aaca    u c  a                u  acgcuuucgggccgcgccgucgcuac 
Get sequence
Deep sequencing
1855 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr13: 6181370-6181487 [+]
intergenic
Database links

Mature sequence vvi-miR172b

Accession MIMAT0005700
Sequence

88 - 

ugaaucuugaugaugcuacac

 - 108

Get sequence
Deep sequencing1848 reads, 2 experiments
Evidence by similarity; MI0002288

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).