Stem-loop sequence vvi-MIR172c

AccessionMI0006546 (change log)
DescriptionVitis vinifera miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

10 open access papers mention vvi-MIR172c
(38 sentences)

Stem-loop
   --gu    g a  g                a  a  auu    cu  gug  ug   -gu  u  u    u 
5'     uugc g ug agcaucaucaagauuc ca gu   gaga  ca   cg  gug   ga gg gacu u
       |||| | || |||||||||||||||| || ||   ||||  ||   ||  |||   || || |||| u
3'     aacg c ac ucguaguaguucuaag gu ua   uucu  gu   gc  cac   cu cc cugg g
   aaau    g g  g                g  g  -gu    cg  --a  cu   auc  u  -    u 
Get sequence
Deep sequencing
1858 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr13: 3217507-3217644 [+]
intergenic
Database links

Mature sequence vvi-miR172c

Accession MIMAT0005701
Sequence

108 - 

ggaaucuugaugaugcugcag

 - 128

Get sequence
Deep sequencing1850 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).