Stem-loop sequence vvi-MIR172d

AccessionMI0006547 (change log)
DescriptionVitis vinifera miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

9 open access papers mention vvi-MIR172d
(37 sentences)

Stem-loop
   --guua  u                     a  c -   -uggaag     u     
5'       gc gaugcagcaucaucaagauuc ca c caa       ggcag gaug 
         || ||||||||||||||||||||| || | |||       ||||| ||| c
3'       cg uuacgucguaguaguucuaag gu g guu       ccguc cuaa 
   aaguga  c                     a  a a   uuagaaa     u     
Get sequence
Deep sequencing
1880 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr8: 12667173-12667281 [+]
intergenic
Database links

Mature sequence vvi-miR172d

Accession MIMAT0005702
Sequence

77 - 

ugagaaucuugaugaugcugcau

 - 99

Get sequence
Deep sequencing1871 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).