Stem-loop sequence vvi-MIR319b

AccessionMI0006548 (change log)
DescriptionVitis vinifera miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

7 open access papers mention vvi-MIR319b
(28 sentences)

Stem-loop
   u      ---gaa                   uc  a       ucaa      u   ug   g   ac      cu       cu    a   aggcc 
5'  guggaa      ggagcucucuuuaguccag  cg gacagcu    ggcuga acg  gcu cug  ucguug  ucaagaa  cauc cau     u
    ||||||      |||||||||||||||||||  || |||||||    |||||| |||  ||| |||  ||||||  |||||||  |||| |||     g
3'  caccuu      ccucgagggaagucagguu  gc cugucgg    uugacu ugc  cga gac  agcaac  aguuuuu  guag gua     g
   a      auguuc                   cu  a       --ua      -   gu   g   gu      cu       ug    -   gaaaa 
Get sequence
Deep sequencing
387 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr1: 4189562-4189755 [+]
intergenic
Database links

Mature sequence vvi-miR319b

Accession MIMAT0005703
Sequence

163 - 

uuggacugaagggagcucccu

 - 183

Get sequence
Deep sequencing345 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).