Stem-loop sequence vvi-MIR319c

AccessionMI0006549 (change log)
DescriptionVitis vinifera miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

7 open access papers mention vvi-MIR319c
(25 sentences)

Stem-loop
   --uua  u     a     uu          cu      ug  ag       g    a -  g   ac       uc  aa     u  uaa 
5'      ca ugaag gagcu  cuucagucca  cauggg  gc  uaggauu aauu g cu ccg  ucauuca  ca  uacug gu   g
        || ||||| |||||  ||||||||||  ||||||  ||  ||||||| |||| | || |||  |||||||  ||  ||||| ||    
3'      gu acuuc cucga  gaagucaggu  gugucc  cg  auucuag uuaa c ga ggc  aguaagu  gu  augac ca   g
   cuaac  c     c     gg          uc      cu  -a       g    a a  g   gu       ua  aa     c  uca 
Get sequence
Deep sequencing
6748 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr2: 855561-855742 [-]
intergenic
Database links

Mature sequence vvi-miR319c

Accession MIMAT0005704
Sequence

151 - 

uuggacugaagggagcucccu

 - 171

Get sequence
Deep sequencing380 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).