Stem-loop sequence vvi-MIR319g

AccessionMI0006551 (change log)
DescriptionVitis vinifera miR319g stem-loop
Gene family MIPF0000010; MIR159
Literature search

7 open access papers mention vvi-MIR319g
(24 sentences)

Stem-loop
   -gaaca   -gaa                   aa  a    u   g -    -cc  -a   g    c       cuu     u     ------u  u    u  au  -       
5'       gcu    gagcuccuuuuaguccaau  ag gggc gag g gcgg   ag  gcu ccau ucaugca   ggcua gcuua       uc uuuc ca  ca auucgg 
         |||    |||||||||||||||||||  || |||| ||| | ||||   ||  ||| |||| |||||||   ||||| |||||       || |||| ||  || ||||| u
3'       cgg    cucgagggaagucagguua  uc cccg uuc c cgcc   uc  cga ggua aguacgu   ccgau ugaau       ag gagg gu  gu ugagcu 
   ucuaga   gacc                   -c  a    u   g a    ucc  aa   g    c       agu     u     cguaaac  u    u  cg  a       
Get sequence
Deep sequencing
350 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 3675978-3676199 [-]
intergenic
Database links

Mature sequence vvi-miR319g

Accession MIMAT0005706
Sequence

192 - 

uuggacugaagggagcuccca

 - 212

Get sequence
Deep sequencing345 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).