Stem-loop sequence vvi-MIR394a

AccessionMI0006554 (change log)
DescriptionVitis vinifera miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

2 open access papers mention vvi-MIR394a
(4 sentences)

Stem-loop
   --                 u   u         ugcacaucaug 
5'   cagagccauuuuggcau cug ccaccucca           g
     ||||||||||||||||| ||| |||||||||           g
3'   gucucggugaaaccgua gac gguggaggu           u
   au                 c   c         uuucuuauauc 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr12: 17122004-17122092 [-]
intergenic
Database links

Mature sequence vvi-miR394a

Accession MIMAT0005709
Sequence

11 - 

uuggcauucuguccaccuccau

 - 32

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).