Stem-loop sequence vvi-MIR394b

AccessionMI0006555 (change log)
DescriptionVitis vinifera miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention vvi-MIR394b
(12 sentences)

Stem-loop
   -         -a      u c           -  ucucuu     uc 
5'  acagaguuu  uuggca u uguccaccucc ca      gaaaa  u
    |||||||||  |||||| | ||||||||||| ||      |||||   
3'  ugucucgaa  aaccgu a acggguggagg gu      cuuuu  c
   u         cc      c u           u  --cucu     cu 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr18: 1413038-1413130 [-]
intergenic
Database links

Mature sequence vvi-miR394b

Accession MIMAT0005710
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Deep sequencing44 reads, 2 experiments
Evidence by similarity; MI0002314

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).