miRBase entry: vvi-MIR395d

Stem-loop vvi-MIR395d


Accession
MI0006559
Description
Vitis vinifera vvi-MIR395d precursor miRNA
Gene family
MIPF0000016; MIR395

Literature search
6 open access papers mention vvi-MIR395d
(23 sentences)

Sequence

7051 reads, 475 reads per million, 2 experiments
gcccccuagaguuccccugaccacuucauuggggaucuucucuaaugacuuccuaCUGAAGUGUUUGGGGGAACUCcuggugucau
....((..((((((((((((.(((((((.((((((((.........)).)))))).))))))).))))))))))))..))......

Structure
--gccc  ua            c       u      -  uuc 
      cc  gaguuccccuga cacuuca ugggga uc   u
      ||  |||||||||||| ||||||| |||||| ||   c
      gg  CUCAAGGGGGUU GUGAAGU auccuu ag   u
uacugu  uc            U       C      c  uaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6512763-6512848 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR395d
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395d

Accession MIMAT0005714
Description Vitis vinifera vvi-miR395d mature miRNA
Sequence 56 - CUGAAGUGUUUGGGGGAACUC - 76
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558