miRBase entry: vvi-MIR395e

Stem-loop vvi-MIR395e


Accession
MI0006560
Description
Vitis vinifera vvi-MIR395e precursor miRNA

Literature search
6 open access papers mention vvi-MIR395e
(23 sentences)

Sequence

7105 reads, 477 reads per million, 2 experiments
cuccccuagaguucccuugaccacuucacuggggaccuucucuaauuauaaugacuuccuaCUGAAGUGUUUGGGGGAACUCcuggugccau
....((..((((((((((((.(((((((.((((((...((............)).)))))).))))))).))))))))))))..))......

Structure
--cucc  ua            c       c      ccu  ucuaa 
      cc  gaguucccuuga cacuuca ugggga   uc     u
      ||  |||||||||||| ||||||| ||||||   ||      
      gg  CUCAAGGGGGUU GUGAAGU auccuu   ag     u
uaccgu  uc            U       C      --c  uaaua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 6505248-6505339 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from vvi-MIR395e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR395e

Accession MIMAT0005715
Description Vitis vinifera vvi-miR395e mature miRNA
Sequence 62 - CUGAAGUGUUUGGGGGAACUC - 82
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558