Stem-loop sequence vvi-MIR408

AccessionMI0006578 (change log)
DescriptionVitis vinifera miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

5 open access papers mention vvi-MIR408
(17 sentences)

Stem-loop
   a    ga   --      c              a    a uauu     aagaa 
5'  agag  aga  cgggga gagguagugcaugg ugga c    aacag     u
    ||||  |||  |||||| |||||||||||||| |||| |    |||||      
3'  ucuc  ucu  gucccu cuccgucacguacc aucu g    uuguc     g
   c    ug   cg      u              c    c -uuu     gaauu 
Get sequence
Deep sequencing
64010 reads, 4.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr7: 5011935-5012041 [+]
intergenic
Database links

Mature sequence vvi-miR408

Accession MIMAT0005733
Sequence

77 - 

augcacugccucuucccuggc

 - 97

Get sequence
Deep sequencing9825 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).