Stem-loop sequence mml-mir-513b-1

AccessionMI0006616 (change log)
DescriptionMacaca mulatta miR-513b-1 stem-loop
Gene family MIPF0000130; mir-506
Literature search

2 open access papers mention mml-mir-513b-1
(61 sentences)

Stem-loop
   -uu    g   -     a          u       -  ga 
5'    uaca ugc cuuuc caaggaggug cauuuau gu  a
      |||| ||| ||||| |||||||||| ||||||| ||  c
3'    augu aug gaagg guuuuuccac guaaaua ca  u
   aac    a   a     -          u       u  aa 
Get sequence
Deep sequencing
1115 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140902107-140902187 [-]
intergenic
JSUE03316628.1: 559-639 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-513b-1
mml-mir-513b-2chrX: 140909241-140909321 [-]
mml-mir-513b-1chrX: 140902107-140902187 [-]
Database links

Mature sequence mml-miR-513b

Accession MIMAT0005767
Sequence

13 - 

uucacaaggaggugucauuuau

 - 34

Get sequence
Deep sequencing1800 reads, 9 experiments
Evidence by similarity; MI0003192
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).