Stem-loop sequence mml-mir-513a-3

AccessionMI0006620 (change log)
DescriptionMacaca mulatta miR-513a-3 stem-loop
Gene family MIPF0000130; mir-506
Literature search

2 open access papers mention mml-mir-513a-3
(57 sentences)

Stem-loop
              c    a   gg     u       -  ga 
5' cuguacauugc uuuc cag  aggug cauuuau gu  a
   ||||||||||| |||| |||  ||||| ||||||| ||  c
3' gacauguaaug gaag guc  uucac guaaaua ca  u
              a    a   uu     u       u  aa 
Get sequence
Deep sequencing
1892 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140941885-140941966 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-513a-3
mml-mir-507chrX: 140947139-140947232 [-]
mml-mir-506chrX: 140946806-140946914 [-]
mml-mir-513a-3chrX: 140941885-140941966 [-]
mml-mir-513a-2chrX: 140933333-140933412 [-]
Database links

Mature sequence mml-miR-513a

Accession MIMAT0005768
Sequence

14 - 

uucacagggaggugucauuuau

 - 35

Get sequence
Deep sequencing2976 reads, 8 experiments
Evidence by similarity; MI0003191
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).