Stem-loop sequence ptr-mir-514-2

AccessionMI0006634 (change log)
DescriptionPan troglodytes miR-514-2 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   ugu    -    g   c      -    g    a      u  aua 
5'    uguc ugug uac cuacuc ugga agug caauca gu   a
      |||| |||| ||| |||||| |||| |||| |||||| ||    
3'    acag acgc aug gaugag gucu ucac guuagu ua   c
   ---    u    a   a      u    -    a      u  aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 147013243-147013330 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-514-2
ptr-mir-514-4chrX: 147016809-147016893 [-]
ptr-mir-514-3chrX: 147015339-147015423 [-]
ptr-mir-514-2chrX: 147013243-147013330 [-]
ptr-mir-514-1chrX: 147010556-147010640 [-]
ptr-mir-510chrX: 147003632-147003728 [-]
Database links

Mature sequence ptr-miR-514

Accession MIMAT0005778
Sequence

55 - 

auugacacuucugugaguag

 - 74

Get sequence
Evidence by similarity; MI0003199
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).