Stem-loop sequence oan-mir-18

Accession MI0006694
Description Ornithorhynchus anatinus miR-18 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--  uaucc     a   -----------u  cc         --   u    c   u     ua  --g     
  gc     auuuc gaa            gu  cuuguguua  agg gcau uag gcagu  gu   aagu 
  ||     ||||| |||            ||  |||||||||  ||| |||| ||| |||||  ||   ||| a
  cg     uaaag cuu            cg  gaacacggu  ucc cgua auc cguca  ua   uucg 
ug  -uacc     -   caacauauaauc  uc         cu   u    a   c     uc  aga     
Get sequence
Genome context
Coordinates (OANA5) Overlapping transcripts
6: 8561213-8561342 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-18
oan-mir-106 6: 8561054-8561167 [+]
oan-mir-18 6: 8561213-8561342 [+]
oan-mir-20b 6: 8561429-8561534 [+]
oan-mir-19b 6: 8561559-8561661 [+]
oan-mir-92a-1 6: 8561691-8561810 [+]
oan-mir-363 6: 8561848-8561936 [+]
Database links

Mature sequence oan-miR-18-5p

Accession MIMAT0006851
Previous IDs oan-miR-18
Sequence

29 - 

uaaggugcaucuagugcagu

 - 48

Get sequence
Evidence experimental; Solexa [1]

Mature sequence oan-miR-18-3p

Accession MIMAT0006852
Previous IDs oan-miR-18*
Sequence

69 - 

uacugcccuaaaugcuccuucu

 - 90

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).