Stem-loop sequence oan-mir-135b

Accession MI0006705
Description Ornithorhynchus anatinus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
   -a  -     uuggcu    g                  uau          uug ug 
cgg  uc cuccc      cucu cuguggccuauggcuuuu   uccuauguga   c  c
|||  || |||||      |||| ||||||||||||||||||   ||||||||||   |   
gcc  ag gaggg      gaga gacaucggguaccgaaag   gggauguacu   g  u
   ac  a     ------    -                  -uc          caa uu
Get sequence
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig10074: 3245-3358 [-]
intergenic
Database links

Mature sequence oan-miR-135b-5p

Accession MIMAT0006870
Previous IDs oan-miR-135b
Sequence

31 -  

uauggcuuuuuauuccuauguga

 - 53

Get sequence
Evidence experimental; Solexa [1]

Mature sequence oan-miR-135b-3p

Accession MIMAT0006871
Previous IDs oan-miR-135b*
Sequence

70 -  

auguagggcugaaagccauggg

 - 91

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).