Stem-loop sequence oan-let-7b

AccessionMI0006720 (change log)
DescriptionOrnithorhynchus anatinus let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
       ug                    ucaggggagugauuu 
5' ggga  agguaguagguugugugguu               u
   ||||  ||||||||||||||||||||                
3' cccu  uccgucauccgacauaucaa               g
       --                    uagaagacuaacccc 
Get sequence
Deep sequencing
7481556 reads, 1.21e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig12225: 14105-14186 [-]
intergenic
Database links

Mature sequence oan-let-7b-5p

Accession MIMAT0006897
Previous IDsoan-let-7b
Sequence

5 - 

ugagguaguagguugugugguu

 - 26

Get sequence
Deep sequencing7481377 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-let-7b-3p

Accession MIMAT0006898
Previous IDsoan-let-7b*
Sequence

61 - 

cuauacagccuacugccuuc

 - 80

Get sequence
Deep sequencing173 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).