Stem-loop sequence oan-mir-142

AccessionMI0006772 (change log)
DescriptionOrnithorhynchus anatinus miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   cgaca  c  a ag        g               a         ---ua   g 
5'      ga ag c  acagugca ucauccauaaaguag aagcacuac     aca c
        || || |  |||||||| ||||||||||||||| |||||||||     |||  
3'      cu uc g  ugucaugu aguagguauuucauc uuugugaug     ugu g
   -gagg  -  - gg        g               c         uggga   c 
Get sequence
Deep sequencing
17296 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig23450: 1362-1471 [-]
intergenic
Database links

Mature sequence oan-miR-142-5p

Accession MIMAT0006982
Previous IDsoan-miR-142
Sequence

29 - 

cauaaaguagaaagcacuacu

 - 49

Get sequence
Deep sequencing2056 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-142-3p

Accession MIMAT0006983
Previous IDsoan-miR-142*
Sequence

65 - 

uguaguguuuccuacuuuaugg

 - 86

Get sequence
Deep sequencing15204 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).