Stem-loop sequence oan-mir-128-1

AccessionMI0006787 (change log)
DescriptionOrnithorhynchus anatinus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
   gcuggauucggggccgauacacggucu    --       gagu 
5'                            gagg  gguuuac    c
                              ||||  |||||||     
3'                            cucu  ccaagug    u
   -----------------uugacuuuuu    gg       acac 
Get sequence
Deep sequencing
130825 reads, 1.84e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig290019: 34-104 [-]
Database links

Mature sequence oan-miR-128-3p

Accession MIMAT0007006
Previous IDsoan-miR-128

44 - 


 - 64

Get sequence
Deep sequencing260613 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links


PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).