Stem-loop sequence oan-mir-128-1

AccessionMI0006787
DescriptionOrnithorhynchus anatinus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   gcuggauucggggccgauacacggucu    --       gagu 
5'                            gagg  gguuuac    c
                              ||||  |||||||     
3'                            cucu  ccaagug    u
   -----------------uugacuuuuu    gg       acac 
Get sequence
Deep sequencing
14208 reads, 831 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig290019: 34-104 [-]
intergenic
Database links

Mature sequence oan-miR-128-3p

Accession MIMAT0007006
Previous IDsoan-miR-128
Sequence

44 - 

ucacagugaaccggucucuuu

 - 64

Get sequence
Deep sequencing268 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).