Stem-loop sequence oan-let-7g

AccessionMI0006809 (change log)
DescriptionOrnithorhynchus anatinus let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -   a   u        a            ucagg    a a     a 
5'  ucc ggc gagguagu guuuguacaguu     gucu c auacc c
    ||| ||| |||||||| ||||||||||||     |||| | |||||  
3'  ggg ccg uuccguca cggacaugucaa     uaga g uaugg c
   a   a   -        c            -----    g a     c 
Get sequence
Deep sequencing
7624527 reads, 1.33e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig4951: 13333-13423 [+]
sense
ENSOANT00000021469 ; WDR82-201; intron 2
Database links

Mature sequence oan-let-7g-5p

Accession MIMAT0007038
Previous IDsoan-let-7g
Sequence

8 - 

ugagguaguaguuuguacaguu

 - 29

Get sequence
Deep sequencing7624474 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-let-7g-3p

Accession MIMAT0007039
Previous IDsoan-let-7g*
Sequence

65 - 

cuguacaggccacugccuug

 - 84

Get sequence
Deep sequencing48 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).