Stem-loop sequence oan-mir-222a

AccessionMI0006865 (change log)
DescriptionOrnithorhynchus anatinus miR-222a stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
        -  cu u  u     c   auc             -     auc   uau 
5' agaga gc  g ag ugccc uca   gcucaguagucag uguag   cug   u
   ||||| ||  | || ||||| |||   ||||||||||||| |||||   |||   c
3' ucucu cg  c uc auggg agu   ugggucaucgguc acauc   gac   u
        u  au u  c     -   cuc             u     gac   uaa 
Get sequence
Deep sequencing
25689 reads, 300 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra222: 5162121-5162230 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-222a
oan-mir-222aUltra222: 5162121-5162230 [+]
oan-mir-221Ultra222: 5162753-5162845 [+]
Database links

Mature sequence oan-miR-222a-5p

Accession MIMAT0007132
Previous IDsoan-miR-222a*
Sequence

26 - 

cgcucaguagucaguguagauc

 - 47

Get sequence
Deep sequencing5731 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-222a-3p

Accession MIMAT0007133
Previous IDsoan-miR-222a
Sequence

64 - 

agcuacaucuggcuacugggu

 - 84

Get sequence
Deep sequencing19956 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).