Stem-loop sequence oan-mir-128-2

AccessionMI0006892 (change log)
DescriptionOrnithorhynchus anatinus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
   -cagggcuggcgauuggacagccggaaggggggccguua      aa    g gag 
5'                                        cacugu  gaga u   u
                                          ||||||  |||| |    
3'                                        gugaca  cucu g   a
   ggcagacccucggucuaggucagcccuuucucuggccaa      --    g acc 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra389: 820000-820110 [-]
ENSOANT00000002177 ; ARPP21-201; intron 16
Database links

Mature sequence oan-miR-128-5p

Accession MIMAT0007175
Previous IDsoan-miR-128*

7 - 


 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence oan-miR-128-3p

Accession MIMAT0007006
Previous IDsoan-miR-128

65 - 


 - 85

Get sequence
Evidence experimental; Illumina [1]
Database links


PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).