Stem-loop sequence oan-mir-128-2

AccessionMI0006892 (change log)
DescriptionOrnithorhynchus anatinus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   -cagggcuggcgauuggacagccggaaggggggccguua      aa    g gag 
5'                                        cacugu  gaga u   u
                                          ||||||  |||| |    
3'                                        gugaca  cucu g   a
   ggcagacccucggucuaggucagcccuuucucuggccaa      --    g acc 
Get sequence
Deep sequencing
143465 reads, 1.96e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra389: 820000-820110 [-]
sense
ENSOANT00000002177 ; ARPP21-201; intron 16
Database links

Mature sequence oan-miR-128-5p

Accession MIMAT0007175
Previous IDsoan-miR-128*
Sequence

7 - 

uggcgauuggacagccggaag

 - 27

Get sequence
Deep sequencing471 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-128-3p

Accession MIMAT0007006
Previous IDsoan-miR-128
Sequence

65 - 

ucacagugaaccggucucuuu

 - 85

Get sequence
Deep sequencing260613 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).