Stem-loop sequence oan-mir-128-2

AccessionMI0006892
DescriptionOrnithorhynchus anatinus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   ca gg    c  - ug  --   c   a          uua      aa    g gag 
5'   g  cugg ga u  ga  cag cgg aggggggccg   cacugu  gaga u   u
     |  |||| || |  ||  ||| ||| ||||||||||   ||||||  |||| |    
3'   c  gacc cu g  cu  guc gcc uuucucuggc   gugaca  cucu g   a
   gg -a    -  c gu  ag   a   c          caa      --    g acc 
Get sequence
Deep sequencing
44117 reads, 2.56e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra389: 820000-820110 [-]
sense
ENSOANT00000002177 ; ARPP21-201; intron 16
Database links

Mature sequence oan-miR-128-5p

Accession MIMAT0007175
Previous IDsoan-miR-128*
Sequence

7 - 

uggcgauuggacagccggaag

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence oan-miR-128-3p

Accession MIMAT0007006
Previous IDsoan-miR-128
Sequence

65 - 

ucacagugaaccggucucuuu

 - 85

Get sequence
Deep sequencing268 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).