Stem-loop sequence oan-let-7f-2

AccessionMI0006895 (change log)
DescriptionOrnithorhynchus anatinus let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ----gaau    ag  uu  ugu  u  u     u   gu               ----         au 
5'         auga  ac  gc   gc cu uggga gag  aguagauuguauagu    uuuaggguc  a
           ||||  ||  ||   || || ||||| |||  |||||||||||||||    |||||||||   
3'         ugcu  ug  cg   ug gg acccu uuc  ucaucugacauauca    agguucuag  c
   cuauagcc    cu  -u  --u  u  c     -   ug               auag         cc 
Get sequence
Deep sequencing
13209139 reads, 2.24e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra403: 72417-72546 [-]
sense
ENSOANT00000001129 ; HUWE1-202; intron 57
ENSOANT00000001130 ; HUWE1-201; intron 63
Clustered miRNAs
< 10kb from oan-let-7f-2
oan-let-7f-2Ultra403: 72417-72546 [-]
oan-mir-98Ultra403: 71661-71809 [-]
Database links

Mature sequence oan-let-7f-5p

Accession MIMAT0007179
Previous IDsoan-let-7f
Sequence

31 - 

ugagguaguagauuguauaguu

 - 52

Get sequence
Deep sequencing26475116 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-let-7f-2-3p

Accession MIMAT0009171
Previous IDsoan-let-7f-2*
Sequence

81 - 

cuauacagucuacugucuuuc

 - 101

Get sequence
Deep sequencing552 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).