Stem-loop sequence oan-mir-99

AccessionMI0006897 (change log)
DescriptionOrnithorhynchus anatinus miR-99 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
     g    aa     -gu       a     u   uc   u      gugaa 
5' gu ugau  ugcca   uggcaua acccg aga  cga cuugug     g
   || ||||  |||||   ||||||| ||||| |||  ||| ||||||     u
3' ca gcua  auggu   acugugu ugggu ucu  gcu gaacac     g
     g    --     gug       c     c   cc   c      auaaa 
Get sequence
Deep sequencing
965131 reads, 1.4e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra41: 2045338-2045439 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-99
oan-mir-99Ultra41: 2045338-2045439 [+]
oan-let-7c-2Ultra41: 2047378-2047444 [+]
Database links

Mature sequence oan-miR-99-5p

Accession MIMAT0007183
Previous IDsoan-miR-99
Sequence

24 - 

aacccguagauccgaucuugu

 - 44

Get sequence
Deep sequencing964826 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-99-3p

Accession MIMAT0007184
Previous IDsoan-miR-99*
Sequence

61 - 

caagcucgccucucugggucug

 - 82

Get sequence
Deep sequencing304 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).