Stem-loop sequence oan-let-7d

AccessionMI0006934 (change log)
DescriptionOrnithorhynchus anatinus let-7d stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gaagaaacuau    u       a              c      ------   -      u 
5'            gggc ccuagga gagguaguagguug auaguu      uua gggcag g
              |||| ||||||| |||||||||||||| ||||||      ||| |||||| a
3'            uucg ggauucu uuccgucguccaac uaucaa      aau cucguu u
   --cauuauuau    -       -              a      uugugg   a      u 
Get sequence
Deep sequencing
176814 reads, 2.7e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 34976975-34977090 [-]
intergenic
Clustered miRNAs
< 10kb from oan-let-7d
oan-let-7f-1X1: 34978329-34978477 [-]
oan-let-7dX1: 34976975-34977090 [-]
Database links

Mature sequence oan-let-7d-5p

Accession MIMAT0007234
Previous IDsoan-let-7d
Sequence

24 - 

agagguaguagguugcauaguu

 - 45

Get sequence
Deep sequencing176355 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-let-7d-3p

Accession MIMAT0007235
Previous IDsoan-let-7d*
Sequence

78 - 

cuauacaaccugcugccuuucu

 - 99

Get sequence
Deep sequencing431 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).