Stem-loop sequence oan-let-7f-1

AccessionMI0006962 (change log)
DescriptionOrnithorhynchus anatinus let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ----------------uuugcuaaggauggau      gg   a ug                    --------uuu       u 
5'                                 ugcucu  cag g  agguaguagauuguauaguu           aggguag a
                                   ||||||  ||| |  ||||||||||||||||||||           ||||||| a
3'                                 acgagg  guc c  uccguuaucuaacauaucaa           uccuauu u
   aguuugggccuaucuuugguggcaucuuuaag      -a   - cu                    uagaggccuuu       u 
Get sequence
Deep sequencing
13267079 reads, 2.24e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 34978329-34978477 [-]
intergenic
Clustered miRNAs
< 10kb from oan-let-7f-1
oan-let-7f-1X1: 34978329-34978477 [-]
oan-let-7dX1: 34976975-34977090 [-]
Database links

Mature sequence oan-let-7f-5p

Accession MIMAT0007179
Previous IDsoan-let-7f
Sequence

30 - 

ugagguaguagauuguauaguu

 - 51

Get sequence
Deep sequencing26475116 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-let-7f-1-3p

Accession MIMAT0007180
Previous IDsoan-let-7f-1*
Sequence

87 - 

cuauacaaucuauugccuuc

 - 106

Get sequence
Deep sequencing220 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).