Stem-loop sequence osa-MIR1425

Accession

MI0006965 (change log)

Description

Oryza sativa miR1425 stem-loop

Literature search

15 open access papers mention osa-MIR1425
(59 sentences)

Stem-loop

             c           auc         -  --a         ua 
5' cuguugacug auuaggauuca   cuugcugcu aa   uguauugcu  u
   |||||||||| |||||||||||   ||||||||| ||   |||||||||  a
3' gauagcugau uaauucuaggu   gaacgacga uu   auauaacga  u
             a           caa         c  gua         cu 

Deep sequencing

1797 reads, 1.1e+03 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr5: 8862149-8862250 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0006965

Mature sequence osa-miR1425-5p

• Accession: MIMAT0005959
• Previous IDs: osa-miR1425
• Sequence: 14 - uaggauucaauccuugcugcu - 34
• Deep sequencing: 1599 reads, 2 experiments
• Evidence: experimental; MPSS [1], Northern [1], cloned [2-3]
• Database links:
  • RNAcentral:URS00004F38F3_39947

Mature sequence osa-miR1425-3p

• Accession: MIMAT0020933
• Sequence: 71 - cagcaagaacuggaucuuaau - 91
• Deep sequencing: 198 reads, 2 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS00002BD412_39947

References

1. PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2. PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3. PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).
4. PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).