Stem-loop sequence osa-MIR1426

AccessionMI0006966 (change log)
DescriptionOryza sativa miR1426 stem-loop
Literature search

1 open access papers mention osa-MIR1426
(1 sentences)

Stem-loop
   aaaua   uc    ug       aa  ga   acgauaggcaggccgugaagcaaauauguaag 
5'      gaa  uuga  augauua  ag  ggg                                a
        |||  ||||  |||||||  ||  |||                                c
3'      cuu  agcu  uacuaau  uu  ccc                                g
   -aaaa   uu    ua       ag  ac   aaaaaaaaagugaaagaucuuaagggccguug 
Get sequence
Deep sequencing
4802 reads, 3.2e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 7189218-7189347 [-]
intergenic
Database links

Mature sequence osa-miR1426

Accession MIMAT0005960
Sequence

5 - 

agaaucuugaugaugauuaaa

 - 25

Get sequence
Deep sequencing4758 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1]

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).