Stem-loop sequence osa-MIR1428a

Accession

MI0006968 (change log)

Previous IDs

osa-MIR1428

Description

Oryza sativa miR1428a stem-loop

Gene family

MIPF0000575; MIR1428

Literature search

5 open access papers mention osa-MIR1428a
(20 sentences)

Stem-loop

   gguua u                 a   cc            u aa  g        au  u 
5'      g gcguuuugcaaauucgc ggc  uaucuuguggua g  cu aguacgcg  ga u
        | ||||||||||||||||| |||  |||||||||||| |  || ||||||||  ||  
3'      c ugcaaaacguuuaagug ccg  auagaauaccau c  gg uuaugcgu  cu u
   ----a u                 -   aa            u gg  g        -c  a 

Deep sequencing

3 reads, 0 reads per million, 1 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr1: 13160777-13160896 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0006968

Mature sequence osa-miR1428a-5p

• Accession: MIMAT0005962
• Previous IDs: osa-miR1428
• Sequence: 9 - cguuuugcaaauucgcaggcc - 29
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; MPSS [1], Northern [1], cloned [2]

Mature sequence osa-miR1428a-3p

• Accession: MIMAT0007280
• Sequence: 89 - uaagauaaagccgugaauuug - 109
• Evidence: experimental; 454 [3]

References

1. PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2. PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3. PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).