Stem-loop sequence osa-MIR1432

AccessionMI0006972 (change log)
DescriptionOryza sativa miR1432 stem-loop
Literature search

21 open access papers mention osa-MIR1432
(44 sentences)

Stem-loop 
         a     a           ga     -c    ------       cu    c 
5' ccugug ucagg gagaugacacc  caucg  cgga      auucguu  uggu u
   |||||| ||||| |||||||||||  |||||  ||||      |||||||  |||| u
3' ggauac agucc cucuacugugg  guagu  gccu      uaaguag  accg g
         a     c           ac     uu    gguagu       -u    u
Get sequence
Deep sequencing
980 reads, 600 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 23401702-23401810 [-]
intergenic
Database links

Mature sequence osa-miR1432-5p

Accession MIMAT0005966
Sequence

7 -  

aucaggagagaugacaccgac

 - 27

Get sequence
Deep sequencing979 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2], 454 [3]
Database links

Mature sequence osa-miR1432-3p

Accession MIMAT0022950
Sequence

84 -  

caggugucaucuccccugaac

 - 104

Get sequence
Evidence experimental; Illumina [4]

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3
PMID:18323537 "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa" Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ Genome Res. 18:571-584(2008).
4
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).