![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-551 |
|||||
Accession | MI0006983 (change log) | ||||
Description | Gallus gallus miR-551 stem-loop | ||||
Gene family | MIPF0000360; mir-551 | ||||
Literature search |
1 open access papers mention gga-mir-551 | ||||
Stem-loop |
-- - c - a gg aagac - g 5' ccacca ga g ugccc cauggcucc gaaaucaag ugggu cuugu ag a |||||| || | ||||| ||||||||| ||||||||| ||||| ||||| || u 3' gguggu cu c auggg gugucgggg cuuugguuc accca ggacg uc a ga g u u a au ---gc g a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence gga-miR-551-5p |
|
Accession | MIMAT0007289 |
Previous IDs | gga-miR-551* |
Sequence |
26 - gaaaucaaggguggguaagaccu - 48 |
Deep sequencing | 26 reads, 2 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
Mature sequence gga-miR-551-3p |
|
Accession | MIMAT0007290 |
Previous IDs | gga-miR-551 |
Sequence |
66 - gcgacccauacuugguuucag - 86 |
Deep sequencing | 349 reads, 4 experiments |
Evidence | experimental; cloned [1-2], Illumina [3] |
Predicted targets |
|
References |
|
1 |
PMID:18463306
"Conservation of small RNA pathways in platypus"
Genome Res. 18:995-1004(2008).
|
2 |
PMID:18511220
"Identification of novel chicken microRNAs and analysis of their genomic organization"
Gene. 418:34-40(2008).
|
3 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|