|
miRBase |
|
Stem-loop sequence gga-mir-551 |
|||||
| Accession | MI0006983 | ||||
| Description | Gallus gallus miR-551 stem-loop | ||||
| Gene family | MIPF0000360; mir-551 | ||||
| Stem-loop |
-- - c - a gg aagac - g ccacca ga g ugccc cauggcucc gaaaucaag ugggu cuugu ag a |||||| || | ||||| ||||||||| ||||||||| ||||| ||||| || u gguggu cu c auggg gugucgggg cuuugguuc accca ggacg uc a ga g u u a au ---gc g a |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence gga-miR-551-5p |
|
| Accession | MIMAT0007289 |
| Previous IDs | gga-miR-551* |
| Sequence |
26 - gaaaucaaggguggguaagaccu - 48 |
| Evidence | experimental; cloned [1] |
| Predicted targets |
|
Mature sequence gga-miR-551-3p |
|
| Accession | MIMAT0007290 |
| Previous IDs | gga-miR-551 |
| Sequence |
66 - gcgacccauacuugguuucag - 86 |
| Evidence | experimental; cloned [1-2], Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18463306
"Conservation of small RNA pathways in platypus"
Genome Res. 18:995-1004(2008).
|
| 2 |
PMID:18511220
"Identification of novel chicken microRNAs and analysis of their genomic organization"
Gene. 418:34-40(2008).
|
| 3 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|