Stem-loop sequence gga-mir-551

AccessionMI0006983 (change log)
DescriptionGallus gallus miR-551 stem-loop
Gene family MIPF0000360; mir-551
Literature search

1 open access papers mention gga-mir-551
(1 sentences)

Stem-loop
         --  - c     -         a         gg     aagac     -  g 
5' ccacca  ga g ugccc cauggcucc gaaaucaag  ugggu     cuugu ag a
   ||||||  || | ||||| ||||||||| |||||||||  |||||     ||||| || u
3' gguggu  cu c auggg gugucgggg cuuugguuc  accca     ggacg uc a
         ga  g u     u         a         au     ---gc     g  a 
Get sequence
Deep sequencing
393 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 20500004-20500116 [-]
sense
Database links

Mature sequence gga-miR-551-5p

Accession MIMAT0007289
Previous IDsgga-miR-551*
Sequence

26 - 

gaaaucaaggguggguaagaccu

 - 48

Get sequence
Deep sequencing26 reads, 2 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence gga-miR-551-3p

Accession MIMAT0007290
Previous IDsgga-miR-551
Sequence

66 - 

gcgacccauacuugguuucag

 - 86

Get sequence
Deep sequencing349 reads, 4 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).
3
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).