Stem-loop sequence odi-mir-1473

AccessionMI0007084 (change log)
DescriptionOikopleura dioica miR-1473 stem-loop
Stem-loop
   aauccgcacuccguuagaaucuggagccaucgcagauucg      uu     uuu  a 
5'                                         gacuug  guuug   ca a
                                           ||||||  |||||   || u
3'                                         uugggc  cgaac   gu u
   ----------------acgcgucgggcggcguguggcuau      -u     --u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence odi-miR-1473

Accession MIMAT0006024
Sequence

66 - 

ucaagcucggguuuaucggugu

 - 87

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).