Stem-loop sequence csa-mir-1473

AccessionMI0007131 (change log)
DescriptionCiona savignyi miR-1473 stem-loop
Gene family MIPF0000504; mir-1473
Stem-loop
   cgaaacaucauuaaauaaccua   -    c    u    aaucu    u  ug     u 
5'                       cgu gggu uggc ccca     ucga cu  ugaga a
                         ||| |||| |||| ||||     |||| ||  ||||| u
3'                       gca ccua gccg gggu     ggcu ga  acucu a
   -------------------aca   a    c    u    auuuu    c  --     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_44: 256366-256466 [+]
intergenic
Clustered miRNAs
< 10kb from csa-mir-1473
csa-mir-1473reftig_44: 256366-256466 [+]
csa-let-7dreftig_44: 256943-257044 [+]
Database links

Mature sequence csa-miR-1473

Accession MIMAT0006069
Sequence

66 - 

ucaagcucgguuuuaugggugc

 - 87

Get sequence
Evidence by similarity; MI0007084

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).