Stem-loop sequence odi-let-7c

AccessionMI0007138 (change log)
DescriptionOikopleura dioica let-7c stem-loop
Stem-loop
   ---------a     -       cau     a   gg         --   gaaaau 
5'           ggacu aguucug   gaggu gua  uuaugcugu  ucg      a
             ||||| |||||||   ||||| |||  |||||||||  |||       
3'           ccuga ucaagac   cuccg cgu  aaugcgaca  ggc      a
   acagcuuaua     c       -cu     -   aa         au   aaauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence odi-let-7c

Accession MIMAT0006076
Sequence

15 - 

augagguaguagguuaugcugu

 - 36

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).