Stem-loop sequence odi-let-7d

AccessionMI0007139 (change log)
DescriptionOikopleura dioica let-7d stem-loop
Stem-loop
   -------     -  u    uu a      gg      u    g    ---   u 
5'        cgcca gu ccgu  g gguagu  guugua cgcu aggg   aac a
          ||||| || ||||  | ||||||  |||||| |||| ||||   |||  
3'        guggu cg ggca  c ccauca  caacgu gcgg uccc   uug a
   gcucauc     g  c    uc c      aa      c    -    acu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence odi-let-7d

Accession MIMAT0006077
Sequence

14 - 

ugagguaguggguuguaucgcu

 - 35

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).