Stem-loop sequence cin-let-7a-1

AccessionMI0007149 (change log)
DescriptionCiona intestinalis let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention cin-let-7a-1
(18 sentences)

Stem-loop
   au   -  uga     au       u            u  ag  -----   -   uu 
5'   ggc cg   ccaca  gagguag agguuaugcagu au  cc     ucc cuu  a
     ||| ||   |||||  ||||||| |||||||||||| ||  ||     ||| |||  u
3'   uug gc   ggugu  uuccguc uccaauguguca ua  gg     agg gag  a
   -u   u  uuc     --       u            -  ga  acacg   u   uc 
Get sequence
Deep sequencing
9220 reads, 2.5e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 2082260-2082369 [+]
intergenic
Clustered miRNAs
< 10kb from cin-let-7a-1
cin-let-7a-14q: 2082260-2082369 [+]
cin-let-7f4q: 2082406-2082478 [+]
cin-let-7b4q: 2082788-2082896 [+]
cin-let-7c4q: 2082979-2083088 [+]
cin-let-7a-24q: 2083177-2083286 [+]
Database links

Mature sequence cin-let-7a-5p

Accession MIMAT0006086
Previous IDscin-let-7a
Sequence

17 - 

ugagguaguagguuaugcagu

 - 37

Get sequence
Deep sequencing18406 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-let-7a-1-3p

Accession MIMAT0015247
Previous IDscin-let-7a-1*
Sequence

78 - 

uguguaaccuucugccuuugu

 - 98

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2