Stem-loop sequence cin-let-7a-2

AccessionMI0007150 (change log)
DescriptionCiona intestinalis let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention cin-let-7a-2
(18 sentences)

Stem-loop
   -----au     uc       u   g                 -------u      auu 
5'        aguug  gauauua gag uaguagguuaugcaguu        ugcgac   a
          |||||  ||||||| ||| |||||||||||||||||        ||||||   u
3'        ucgac  cuguaau cuc gucauccgaugugucaa        gcguug   u
   uucucuc     uu       -   a                 uagagguu      cuc 
Get sequence
Deep sequencing
9199 reads, 2.5e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 2083177-2083286 [+]
intergenic
Clustered miRNAs
< 10kb from cin-let-7a-2
cin-let-7a-14q: 2082260-2082369 [+]
cin-let-7f4q: 2082406-2082478 [+]
cin-let-7b4q: 2082788-2082896 [+]
cin-let-7c4q: 2082979-2083088 [+]
cin-let-7a-24q: 2083177-2083286 [+]
Database links

Mature sequence cin-let-7a-5p

Accession MIMAT0006086
Previous IDscin-let-7a
Sequence

17 - 

ugagguaguagguuaugcagu

 - 37

Get sequence
Deep sequencing18406 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-let-7a-2-3p

Accession MIMAT0015248
Previous IDscin-let-7a-2*
Sequence

71 - 

cuguguagccuacugacucua

 - 91

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2