Stem-loop sequence cin-let-7c

AccessionMI0007152 (change log)
DescriptionCiona intestinalis let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention cin-let-7c
(18 sentences)

Stem-loop
   -----------------      g  u     u   g    a       u      a  aua    
5'                  ugaacu au caagu gag uagu gguuaua caguug uu   uga 
                    |||||| || ||||| ||| |||| ||||||| |||||| ||   || a
3'                  auuugg ua guuca uuc auca ccgauau gucaau ga   acc 
   gagaaaaaccaacuuuc      -  c     -   g    c       -      a  -gg    
Get sequence
Deep sequencing
3820 reads, 1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 2082979-2083088 [+]
intergenic
Clustered miRNAs
< 10kb from cin-let-7c
cin-let-7a-14q: 2082260-2082369 [+]
cin-let-7f4q: 2082406-2082478 [+]
cin-let-7b4q: 2082788-2082896 [+]
cin-let-7c4q: 2082979-2083088 [+]
cin-let-7a-24q: 2083177-2083286 [+]
Database links

Mature sequence cin-let-7c

Accession MIMAT0006088
Sequence

16 - 

ugagguaguagguuauaucagu

 - 37

Get sequence
Deep sequencing3814 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2