Stem-loop sequence cin-let-7d

AccessionMI0007153 (change log)
DescriptionCiona intestinalis let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention cin-let-7d
(18 sentences)

Stem-loop
   ------------uc   uau      c    g    u        u   uc c  g 
5'               agc   ucgugg ugag uagu gguuguau guu  c uu u
                 |||   |||||| |||| |||| |||||||| |||  | ||  
3'               ucg   gguacc auuc aucg ccgacaua caa  g aa g
   uaagcaccuaucaa   -uu      a    g    c        u   uu u  u 
Get sequence
Deep sequencing
1586 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
10p: 1217625-1217725 [-]
intergenic
Clustered miRNAs
< 10kb from cin-let-7d
cin-mir-147310p: 1218098-1218177 [-]
cin-let-7d10p: 1217625-1217725 [-]
cin-mir-12510p: 1217517-1217565 [-]
Database links

Mature sequence cin-let-7d-5p

Accession MIMAT0006089
Previous IDscin-let-7d
Sequence

16 - 

ugagguaguugguuguauuguu

 - 37

Get sequence
Deep sequencing1583 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

Mature sequence cin-let-7d-3p

Accession MIMAT0015250
Previous IDscin-let-7d*
Sequence

56 - 

cuauacagcccgcuagcuu

 - 74

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3