Stem-loop sequence cin-let-7e

AccessionMI0007154 (change log)
DescriptionCiona intestinalis let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention cin-let-7e
(18 sentences)

Stem-loop
   --------uc   u  uc    c    g    u        c    cc uug 
5'           agc au  gugg ugag uagu gguuguau gguu  c   u
             ||| ||  |||| |||| |||| |||||||| ||||  |   g
3'           ucg ug  uacc auuc aucg ccgacaua ucaa  g   a
   caccuaucaa   u  gu    a    a    c        -    uu uaa 
Get sequence
Deep sequencing
1113 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cin-let-7e

Accession MIMAT0006090
Sequence

16 - 

ugagguaguugguuguaucggu

 - 37

Get sequence
Deep sequencing1111 reads, 2 experiments
Evidence by similarity; MI0007153

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).