Stem-loop sequence cin-mir-7

AccessionMI0007155 (change log)
DescriptionCiona intestinalis miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

4 open access papers mention cin-mir-7
(11 sentences)

Stem-loop
   aua     ac   -  u   a     gu    -       u 
5'    uccgc  ccg gu gga gacua  gauu uuguugu a
      |||||  ||| || ||| |||||  |||| |||||||  
3'    aggug  ggc cg ccu cuggu  cuaa aacaacg u
   ---     aa   a  u   -     au    c       a 
Get sequence
Deep sequencing
291 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1p: 1774516-1774593 [-]
intergenic
Database links

Mature sequence cin-miR-7-5p

Accession MIMAT0006091
Previous IDscin-miR-7
Sequence

16 - 

uggaagacuagugauuuuguug

 - 37

Get sequence
Deep sequencing289 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-miR-7-3p

Accession MIMAT0015251
Previous IDscin-miR-7*
Sequence

47 - 

caacaaucuauggucuccugc

 - 67

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2