Stem-loop sequence cin-mir-31

AccessionMI0007156 (change log)
DescriptionCiona intestinalis miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   -----------aug   -     u   u   a             g    u    a 
5'               uaa cuggu cua ggc agauguuggcaua cuau ucac u
                 ||| ||||| ||| ||| ||||||||||||| |||| |||| g
3'               auu gauca ggu ucg ucuauaaucgugu gaua agug a
   aacgcaacuaaaga   c     u   u   a             -    u    u 
Get sequence
Deep sequencing
370 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
5q: 2076043-2076144 [+]
intergenic
Database links

Mature sequence cin-miR-31

Accession MIMAT0006092
Sequence

16 - 

uggcaagauguuggcauagcua

 - 37

Get sequence
Deep sequencing369 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3