Stem-loop sequence cin-mir-34

AccessionMI0007158 (change log)
DescriptionCiona intestinalis miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

1 open access papers mention cin-mir-34
(2 sentences)

Stem-loop
   uu   c      -   a  c       uu   u       uucuugc           -ug a 
5'   uca gugauu cug gg aguguag  agc aguuguu       cgagauggacu   c u
     ||| |||||| ||| || |||||||  ||| |||||||       |||||||||||   | c
3'   agu cacuaa ggc cc ucacguu  ucg ucaacaa       gcuuuauuugg   g c
   uc   u      a   a  a       uu   -       -------           caa c 
Get sequence
Deep sequencing
1801 reads, 600 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
10q: 2152513-2152631 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-34
cin-mir-3410q: 2152513-2152631 [-]
cin-mir-409110q: 2150745-2150829 [-]
cin-mir-4008a10q: 2149015-2149074 [-]
cin-mir-4008c10q: 2148809-2148870 [-]
cin-mir-4008b10q: 2148360-2148421 [-]
cin-mir-405410q: 2148145-2148201 [-]
Database links

Mature sequence cin-miR-34-5p

Accession MIMAT0006094
Previous IDscin-miR-34
Sequence

16 - 

aggcaguguaguuagcuaguug

 - 37

Get sequence
Deep sequencing1799 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

Mature sequence cin-miR-34-3p

Accession MIMAT0015252
Previous IDscin-miR-34*
Sequence

84 - 

aacugcuuuuugcacuaccacg

 - 105

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3