Stem-loop sequence cin-mir-124-1

AccessionMI0007164 (change log)
DescriptionCiona intestinalis miR-124-1 stem-loop
Gene family MIPF0000021; mir-124
Literature search

3 open access papers mention cin-mir-124-1
(44 sentences)

Stem-loop
   -uau     gua            ga     c    ug 
5'     guucg   guauuuauugug  ccuug ugug  a
       |||||   ||||||||||||  ||||| ||||   
3'     uaagc   cguaaguggcgc  ggaau acac  c
   uuuu     aac            ac     a    ug 
Get sequence
Deep sequencing
88957 reads, 3.65e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 6301475-6301551 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-124-1
cin-mir-124-17q: 6301475-6301551 [+]
cin-mir-124-27q: 6301598-6301696 [+]
Database links

Mature sequence cin-miR-124-1-5p

Accession MIMAT0015256
Previous IDscin-miR-124-1*
Sequence

11 - 

aguauuuauuguggaccuug

 - 30

Get sequence
Deep sequencing1217 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-miR-124-3p

Accession MIMAT0006100
Previous IDscin-miR-124
Sequence

47 - 

uaaggcacgcggugaaugccaa

 - 68

Get sequence
Deep sequencing175349 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2