Stem-loop sequence cin-mir-124-2

AccessionMI0007165 (change log)
DescriptionCiona intestinalis miR-124-2 stem-loop
Gene family MIPF0000021; mir-124
Literature search

3 open access papers mention cin-mir-124-2
(44 sentences)

Stem-loop
   cguaauauuuaaag    -   a   guc            ga     c    ug 
5'               ggcg cuu uga   guguuuacugug  ccuug ugug  a
                 |||| ||| |||   ||||||||||||  ||||| ||||   
3'               ccgc gaa acu   cguaaguggcgc  ggaau acac  c
   ------------cg    u   a   aac            ac     a    ug 
Get sequence
Deep sequencing
89120 reads, 3.66e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 6301598-6301696 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-124-2
cin-mir-124-17q: 6301475-6301551 [+]
cin-mir-124-27q: 6301598-6301696 [+]
Database links

Mature sequence cin-miR-124-2-5p

Accession MIMAT0015257
Previous IDscin-miR-124-2*
Sequence

28 - 

cguguuuacuguggaccuug

 - 47

Get sequence
Deep sequencing1335 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-miR-124-3p

Accession MIMAT0006100
Previous IDscin-miR-124
Sequence

64 - 

uaaggcacgcggugaaugccaa

 - 85

Get sequence
Deep sequencing175349 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2