Stem-loop sequence cin-mir-126

AccessionMI0007166 (change log)
DescriptionCiona intestinalis miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

2 open access papers mention cin-mir-126
(7 sentences)

Stem-loop
   - uu   u c   c       c        c    a  aa 
5'  u  cga g ugc uuguuac uacgguac aggu ga  g
    |  ||| | ||| ||||||| |||||||| |||| ||  u
3'  a  gcu u acg aauaaug gugccaug ucua cu  a
   g gg   c u   a       a        c    -  gu 
Get sequence
Deep sequencing
178 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1q: 1582551-1582631 [+]
intergenic
Database links

Mature sequence cin-miR-126-5p

Accession MIMAT0015258
Previous IDscin-miR-126*
Sequence

12 - 

ccuuguuaccuacgguacc

 - 30

Get sequence
Evidence experimental; Illumina [3]

Mature sequence cin-miR-126-3p

Accession MIMAT0006101
Previous IDscin-miR-126
Sequence

50 - 

ucguaccgugaguaauaaagc

 - 70

Get sequence
Deep sequencing177 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3