Stem-loop sequence cin-mir-141

AccessionMI0007168 (change log)
DescriptionCiona intestinalis miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   ----------u          gg   u       ug        
5'            gguguaucuu  uca auagugu  uagauuc 
              ||||||||||  ||| |||||||  |||||| a
3'            uuacguagaa  ggu ugucaca  aucuagu 
   cucugugcagc          au   c       --        
Get sequence
Deep sequencing
8977 reads, 2.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_71: 128547-128621 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-141
cin-mir-200scaffold_71: 128174-128259 [+]
cin-mir-3575scaffold_71: 128186-128245 [-]
cin-mir-141scaffold_71: 128547-128621 [+]
cin-mir-5611scaffold_71: 128684-128755 [+]
Database links

Mature sequence cin-miR-141-5p

Accession MIMAT0015260
Previous IDscin-miR-141*
Sequence

7 - 

aucuuggucauauaguguug

 - 26

Get sequence
Deep sequencing930 reads, 2 experiments
Evidence experimental; Illumina [3]

Mature sequence cin-miR-141-3p

Accession MIMAT0006103
Previous IDscin-miR-141
Sequence

40 - 

uaacacugucugguaaagaugc

 - 61

Get sequence
Deep sequencing8047 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3