Stem-loop sequence cin-mir-153

AccessionMI0007169 (change log)
DescriptionCiona intestinalis miR-153 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   uaauaaaaugagaau  -    u       -        -c            uu uu 
5'                uc ugug acgugug ucauuuuu  uauuaugcaacu  u  u
                  || |||| ||||||| ||||||||  ||||||||||||  |  u
3'                ag acgc ugcauac agugaaaa  augauacguuga  g  c
   --------------g  u    u       u        ca            uu ua 
Get sequence
Deep sequencing
7421 reads, 2.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
5q: 1421653-1421754 [+]
intergenic
Database links

Mature sequence cin-miR-153-5p

Accession MIMAT0015261
Previous IDscin-miR-153*
Sequence

29 - 

gucauuuuucuauuaugcaa

 - 48

Get sequence
Deep sequencing20 reads, 2 experiments
Evidence experimental; Illumina [3]

Mature sequence cin-miR-153-3p

Accession MIMAT0006104
Previous IDscin-miR-153
Sequence

66 - 

uugcauaguaacaaaagugauc

 - 87

Get sequence
Deep sequencing7350 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3